Phone: + 1 507 4052 660
Email: support@utahwriter.com

activity7 | Biology homework help

Lab 10: Paternity Testing with DNA Fingerprinting

Name: ____________________

Introduction

DNA “fingerprinting” is a powerful tool for comparing two DNA samples. The process is relatively simple. This exercise should help you see how this tool can be applied to forensic and paternity testing.

The Case: A married couple, Joe and Sally (Sally is infertile), arranges with a close friend, Mary, to have a baby. Mary is artificially inseminated with Joe’s sperm. When Mary gives birth to the child, she decides that she wants to keep it. She claims that the child’s biological father is not Joe, but her own husband Dan. You are the DNA technician who has been asked to perform genetic testing to determine the true biological father.

1. Review information about the process of genetic fingerprinting. You can perform an Internet search on the subject if you do not have other reference materials.

2. You have been given the following DNA samples:


Mary

CCTAGACGGCCAGGCACAAGCCAGGCCATGGCCACATCAGTTAGACCGAGGCCGAATCGGCCTTATTGCAGG


Joe

CCGAGGCCAGGGTATACCGGTATAGGCCAATTTGGCCGGCATGGGCCGATACAGCCGATGGCCATATAGGGGG


Dan

CCGGTACATTACCAGGCCAAGGATACGGCAAGCAGGCCTTCATGGCCAAGGCCTTAGCACGGGCCAATGACGG


Baby Jacob

CCACATCAGTTAGACCGAGGCCAAGGCCAACCGACGGCAAGGCCCGACAGGCCAAAGACGGCCATATAGGGGG

3. You have decided to use restriction enzyme Hae III to cut between the GG and CC of each GGCC sequence. (It does NOT remove the GGCC.) Show where the Hae III will cut the DNA. Use your mouse to move the lines to the right into the sequences above.

One cut has been done for you in Mary’s DNA as an example.

4. Since we know that the process of DNA fingerprinting will cause the restriction fragments in each sample to separate according to size, count the number of bases in each fragment. Then fill in the chart on page 2 by copy/pasting each fragment into the correct cell. This chart represents the “gel” that separates DNA by size.

The first restriction fragment produced in Mary’s DNA has been done for you as an example. It was placed in Mary’s column because it comes from Mary’s DNA. It was placed in Base row 9 because this restriction fragment contains 9 bases.

5. You have decided to use a probe that is a small piece of DNA with a sequence of “GTA” that has been labeled with radioactivity. This probe will attach to a section of DNA with the complementary code. What DNA sequence will your GTA probe attach to?

6. Using the Highlighter feature of your word processing program, highlight all of the sequences in the “gel” above that contain the complementary sequence determined in #5. These sequences will have the radioactive probe attached to them.

7.

8. After exposing an x-ray film to the gel, only the areas containing the radioactive probe will leave a cloudy area on the film. These are the same areas you just highlighted and they are known as “genetic markers.” We will now fill in the “film” to the right with gray blocks that represent our markers. They will be located in the same positions as the highlighted fragments above.

9. Remembering that all the markers found in Baby Jacob must be found in either Mary or the father, who will you say is the father of Mary’s baby?

10. If you were serving on the jury in this case, who would you choose to raise the baby? Why?

utahwriter
Unlock Better Papers
Pages (550 words)
Approximate price: -

Why you should choose our essay writing company

Utahwriter is an essay writing company that provides students with the help they need to be successful in their academics. With a skilled team of writers, Utahwriter.com can provide you with top-quality content for any type of paper. We are so confident that our work will meet your needs, we offer a 100% satisfaction guarantee on all orders! If you're looking to get high grades and succeed in school, then don't hesitate to contact us today AND GET;

Amazing deals on our essay writing services

We know you're busy with school and other activities, so we want to make it easier for you by providing amazing deals on the essays that you need. We offer a wide range of discounts depending on how much work is required from us. Don't miss out on this opportunity to get some great grades - contact us today

Perfect papers every time

We are the best essay writing company because we ensure that every paper you receive is 100% original and free of any plagiarism. We have a strict anti-plagiarism policy to maintain our high standards, so rest assured knowing that your content will be unique when you order from Utahwriter.com!

24/7 client support

Our clients come first! That's why we have a 24/7 customer support system in place. We know that you may need some help during the academic process, so if you have any questions or concerns about your order - don't hesitate to ask! Whether it be by email, phone call, live chat with one of our representatives today.

/*

Try it now!

Calculate the price of your order

We'll send you the first draft for approval by at
Total price:
$0.00

How it works?

Place your order

You can order an essay with us by filling out our quick and easy order form.

Proceed with the payment

After receiving payment confirmation via PayPal or credit card – we begin working on your detailed outline, which is based on the requirements given by yourself upon ordering. All work goes through three levels of quality assurance before being sent back to you for review.

Receive the final file

Once approved, your order is complete and will be emailed directly to the email address provided before payment was made!

*/

Benefits of getting that essay from us!

High grades guaranteed

Our well written essays are what professors and tutors are looking for. Our writers are experienced and they know what is expected in every essay. We guarantee you that high score in every essay.

100% original content

We are the best essay writing company because we ensure that every paper you receive is 100% original and free of any plagiarism. We have a strict anti-plagiarism policy to maintain our high standards, so rest assured knowing that your content will be unique when you order from Utahwriter.com

Money back guarantee

We know that you might be worried about the quality of our work, but don't worry! We offer a 100% money back guarantee on all orders. If for any reason you are unsatisfied with anything relating to your order - please contact us within 14 days and we will provide a full refund no questions asked. .

Professional writers only work on your essays!

Our essay writers are not only experienced, but they also have degrees in their field of study. Our experts will write you a custom paper that is tailored to your needs and expectations!

We work 24/7 on every order; no deadlines too tight for us

We know how busy students can be with schoolwork and extra-curricular activities. That's why we work 24/7 so you can get your paper done on time no matter how short of a deadline you have!

Quick response to any questions or concerns

Our writers are professionals and they know that it is important to keep the client updated with every step of their order. We offer quick responses along with all the information you need to know about your essay.